anti arc (Proteintech)
Proteintech is a verified supplier 
93
Structured Review
Proteintech
anti arc
Anti Arc, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/arc+antibody/ARC+Antibody/pmc13008358-369-32-34
Average 93 stars, based on 24 article reviews
Anti Arc, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/arc+antibody/ARC+Antibody/pmc13008358-369-32-34
Average 93 stars, based on 24 article reviews
anti arc - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
SDS Page:Article Title: 2-Deoxy-D-Glucose Treatment Induces Ketogenesis, Sustains Mitochondrial Function, and Reduces Pathology in Female Mouse Model of Alzheimer's Disease Article Snippet: .. Equal amounts of proteins (20 μg/well) were loaded in each well of a 12% SDS-PAGE gel, electrophoresed with a Tris/glycine running buffer, and transferred to a 0.45 μm pore size polyvinylidene difluoride (PVDF) membrane and immunobloted with 6E10 antibody (1∶1000, Covance, Princeton, NJ), sAPPα antibody (1∶500, Covance, Princeton, NJ), PHF13/pTau antibody (1∶500, Covance, Princeton, NJ), PDH E1 alpha antibody (1∶1000, Mitosciences, Eugene, OR), ADAM10 antibody (1∶500, Millipore, Temecula, CA), PS-1 antibody (1∶1000, Millipore, Temecula, CA), BACE1 antibody (1∶500, Covance, Princeton, NJ), FGF-2 antibody (1∶200, Millipore, Temecula, CA), NGFβ antibody (1∶500, Millipore, Temecula, CA) and BDNF antibody (1∶200, Chemicon, Ramona, CA), Pore Size:Article Title: 2-Deoxy-D-Glucose Treatment Induces Ketogenesis, Sustains Mitochondrial Function, and Reduces Pathology in Female Mouse Model of Alzheimer's Disease Article Snippet: .. Equal amounts of proteins (20 μg/well) were loaded in each well of a 12% SDS-PAGE gel, electrophoresed with a Tris/glycine running buffer, and transferred to a 0.45 μm pore size polyvinylidene difluoride (PVDF) membrane and immunobloted with 6E10 antibody (1∶1000, Covance, Princeton, NJ), sAPPα antibody (1∶500, Covance, Princeton, NJ), PHF13/pTau antibody (1∶500, Covance, Princeton, NJ), PDH E1 alpha antibody (1∶1000, Mitosciences, Eugene, OR), ADAM10 antibody (1∶500, Millipore, Temecula, CA), PS-1 antibody (1∶1000, Millipore, Temecula, CA), BACE1 antibody (1∶500, Covance, Princeton, NJ), FGF-2 antibody (1∶200, Millipore, Temecula, CA), NGFβ antibody (1∶500, Millipore, Temecula, CA) and BDNF antibody (1∶200, Chemicon, Ramona, CA), Membrane:Article Title: 2-Deoxy-D-Glucose Treatment Induces Ketogenesis, Sustains Mitochondrial Function, and Reduces Pathology in Female Mouse Model of Alzheimer's Disease Article Snippet: .. Equal amounts of proteins (20 μg/well) were loaded in each well of a 12% SDS-PAGE gel, electrophoresed with a Tris/glycine running buffer, and transferred to a 0.45 μm pore size polyvinylidene difluoride (PVDF) membrane and immunobloted with 6E10 antibody (1∶1000, Covance, Princeton, NJ), sAPPα antibody (1∶500, Covance, Princeton, NJ), PHF13/pTau antibody (1∶500, Covance, Princeton, NJ), PDH E1 alpha antibody (1∶1000, Mitosciences, Eugene, OR), ADAM10 antibody (1∶500, Millipore, Temecula, CA), PS-1 antibody (1∶1000, Millipore, Temecula, CA), BACE1 antibody (1∶500, Covance, Princeton, NJ), FGF-2 antibody (1∶200, Millipore, Temecula, CA), NGFβ antibody (1∶500, Millipore, Temecula, CA) and BDNF antibody (1∶200, Chemicon, Ramona, CA), Immunoprecipitation:Article Title: The Neuronal Gene Arc Encodes a Repurposed Retrotransposon Gag Protein that Mediates Intercellular RNA Transfer Article Snippet: .. Supernatants were immunoprecipitated with either Article Title: Engineered retrovirus-like Arc extracellular vesicles for the in vivo targeted delivery of mRNA into the brain Article Snippet: .. Supernatants were immunoprecipitated with either Gentle:Article Title: The Neuronal Gene Arc Encodes a Repurposed Retrotransposon Gag Protein that Mediates Intercellular RNA Transfer Article Snippet: .. Supernatants were immunoprecipitated with either Article Title: Engineered retrovirus-like Arc extracellular vesicles for the in vivo targeted delivery of mRNA into the brain Article Snippet: .. Supernatants were immunoprecipitated with either other:Article Title: Selective antagonism of adenosine A2A receptor reduces hypobaric hypoxia-induced neuroinflammation by inhibiting cGAS-STING pathway Article Snippet: Equal amounts of protein (20 μg) from each sample were separated using 10% Tris-Gly PAGE and transferred to polyvinylidene difluoride membranes (Merck & Millipore, Burlington, MA, USA). Article Title: Selective antagonism of adenosine A2A receptor reduces hypobaric hypoxia-induced neuroinflammation by inhibiting cGAS-STING pathway. Article Snippet: Gene name The primers’ sequences. (5’-3’) GAPDH Forward AACGACCCCTTCATTGAC Reverse TCCACGACATACTCAGCAC ADORA1 Forward ACATAACTGGCTAGCCCT Reverse CCAAGGTCACACCAAAGCTG ADORA2A Forward CAGAGCAAGAGGCAGGTCAG Forward CAGAGCAAGAGGCAGGTCAG ADORA2B Forward GGAACCGAGACTTCCGCTAC Reverse GACTGAGAGTAGACTGCGCC Tert Forward CTAGCTCATGTGTCAAGACCCTCTT Reverse GCCAGCACGTTTCTCTCGTT D-loop3 Forward TCCTCCGTGAAACCAACAA Reverse AGCGAGAAGAGGGGCATT COX1 Forward TGCTAGCCGCAGGCATTAC Reverse GGGTGCCCAAAGAATCAGAAC mt-ND1 Forward CTAGCAGAAACAAACCGGGC Reverse CCGGCTGCGTATTCTACGTT Western Blotting The hippocampus tissue extracts were prepared using Protein extraction reagent (Thermo Fisher Scientific, 78501) and centrifuged at 12,000 rpm for 10 min at 4°C. Article Title: The Neuronal Gene Arc Encodes a Repurposed Retrotransposon Gag Protein that Mediates Intercellular RNA Transfer Article Snippet: Antibodies Antibodies were used at the following concentrations: Arc (1:000; mouse monoclonal, Santa Cruz), Arc (1:000; |